Site-specific AT-cluster insertions in the mitochondrial 15S rRNA gene of the yeast S. cerevisiae.

نویسندگان

  • A Hüttenhofer
  • H Sakai
  • B Weiss-Brummer
چکیده

By comparing the mitochondrial 15S rRNA sequences of four wildtype yeast strains together with their respective secondary structures, with those of the 16S-like ribosomal RNA from other organisms we detected two optional and two invariant AT-clusters. The origin of these clusters is discussed with respect to their roles as possible mobile elements.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. Wh...

متن کامل

Substitution of an invariant nucleotide at the base of the highly conserved '530-loop' of 15S rRNA causes suppression of yeast mitochondrial ochre mutations.

We have determined the nucleotide sequence alteration in the 15S rRNA gene of a Saccharomyces cerevisiae strain carrying the previously described mitochondrial ochre suppressor, MSUI. The suppressor contains an A residue at position 633 of the yeast mitochondrial sequence, in place of the wild-type G. This position, located in the highly conserved region forming the stem of the '530-loop', corr...

متن کامل

Nuclear Modifier MTO2 Modulates the Aminoglycoside-Sensitivity of Mitochondrial 15S rRNA C1477G Mutation in Saccharomyces cerevisiae

The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we re...

متن کامل

MTO1 Worked as a Modifier in the Aminoglycosides Sensitivity of Yeast Carrying a Mitochondrial 15S rRNA C1477G Mutation

MTO1, together with MSS1 and MTO2, is a gene involved in the pathway of encoding a mitochondria-specific RNA-modifying enzyme related to the post-transcriptional modification of mitochondrial tRNAs. We have previously shown that a mutation of the MTO2 or MSS1 gene can suppress the neomycin-sensitive phenotype of yeast carrying a mitochondrial 15S rRNA C1477G mutation. Here we report that a null...

متن کامل

A single mutation in the 15S rRNA gene confers non sense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Int...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • Nucleic acids research

دوره 16 17  شماره 

صفحات  -

تاریخ انتشار 1988